ID: 1121648210_1121648226

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1121648210 1121648226
Species Human (GRCh38) Human (GRCh38)
Location 14:95535399-95535421 14:95535446-95535468
Sequence CCGGGCAGGCGCCCTCCGCCCCG GCCGAGGGGTTCCGCCGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 330} {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!