ID: 1121715564_1121715570

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1121715564 1121715570
Species Human (GRCh38) Human (GRCh38)
Location 14:96071537-96071559 14:96071571-96071593
Sequence CCATCATTGCTACTACTGTCACC GTGAACACACACTGCCCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 215} {0: 1, 1: 0, 2: 0, 3: 19, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!