ID: 1121765341_1121765353

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1121765341 1121765353
Species Human (GRCh38) Human (GRCh38)
Location 14:96481033-96481055 14:96481074-96481096
Sequence CCCTCTGTGGCCTGTGTGGTAGG CCAGAGTTACAATGCTACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 234} {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!