ID: 1121990120_1121990123

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1121990120 1121990123
Species Human (GRCh38) Human (GRCh38)
Location 14:98549066-98549088 14:98549093-98549115
Sequence CCATCAGGCTGGAGACCCAGGGA ATCCTGTAGATGAAGTTTGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!