ID: 1122078320_1122078323

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1122078320 1122078323
Species Human (GRCh38) Human (GRCh38)
Location 14:99249659-99249681 14:99249676-99249698
Sequence CCGCTGTGTGACCTTGGGTAAAT GTAAATAACTTAACATCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 46, 3: 193, 4: 585} {0: 1, 1: 1, 2: 26, 3: 126, 4: 747}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!