ID: 1122100901_1122100909

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1122100901 1122100909
Species Human (GRCh38) Human (GRCh38)
Location 14:99408926-99408948 14:99408953-99408975
Sequence CCTTCCAAGGCTGTAAGGACCCC CTCAGCAAGGGCCTTCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 140} {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!