ID: 1122154237_1122154240

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122154237 1122154240
Species Human (GRCh38) Human (GRCh38)
Location 14:99740825-99740847 14:99740849-99740871
Sequence CCTGGCATAGATGGGGCCTCAGA GATGCTGGCTCTACACATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 180} {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!