ID: 1122157330_1122157335

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1122157330 1122157335
Species Human (GRCh38) Human (GRCh38)
Location 14:99757776-99757798 14:99757802-99757824
Sequence CCCAATGCCATGAAGCTCCCTGA AAATGTGAGCTTTAAAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169} {0: 1, 1: 0, 2: 5, 3: 66, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!