ID: 1122188063_1122188065

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122188063 1122188065
Species Human (GRCh38) Human (GRCh38)
Location 14:100017062-100017084 14:100017086-100017108
Sequence CCGGAATCCATGTCATTACTCTG TACTTATAGCTGTATGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171} {0: 1, 1: 2, 2: 2, 3: 41, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!