ID: 1122204853_1122204857

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122204853 1122204857
Species Human (GRCh38) Human (GRCh38)
Location 14:100143259-100143281 14:100143283-100143305
Sequence CCTGCAGGAGCTGGGAGGGCAGA CCTCAGCCTCCACTATGTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 59, 4: 580} {0: 1, 1: 0, 2: 0, 3: 17, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!