ID: 1122252448_1122252460

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122252448 1122252460
Species Human (GRCh38) Human (GRCh38)
Location 14:100449458-100449480 14:100449494-100449516
Sequence CCCTGCCCTGGCTGGCTGTTGCA GGCTGTCTCAGCTGGGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303} {0: 1, 1: 0, 2: 1, 3: 35, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!