ID: 1122254563_1122254568

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1122254563 1122254568
Species Human (GRCh38) Human (GRCh38)
Location 14:100467388-100467410 14:100467418-100467440
Sequence CCTGGGATAGGGTTGTGAATGCT CAGGACTCCCACCCGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106} {0: 1, 1: 0, 2: 0, 3: 18, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!