ID: 1122264099_1122264111

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1122264099 1122264111
Species Human (GRCh38) Human (GRCh38)
Location 14:100538670-100538692 14:100538710-100538732
Sequence CCAGCGGGGCCGCCACCGCGGCC AGGGCTGCCCTCGTAGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 56, 4: 632} {0: 1, 1: 0, 2: 0, 3: 12, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!