ID: 1122273203_1122273217

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1122273203 1122273217
Species Human (GRCh38) Human (GRCh38)
Location 14:100577637-100577659 14:100577684-100577706
Sequence CCTCCCGCCAGCGGCCCAGGCGT CTGCCTGTGTTCAGGGACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 168} {0: 1, 1: 0, 2: 2, 3: 20, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!