ID: 1122319553_1122319562

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1122319553 1122319562
Species Human (GRCh38) Human (GRCh38)
Location 14:100845568-100845590 14:100845606-100845628
Sequence CCTTGCTGCTGAGGGTGGGGCCA CCGCCAGGCGGACCTCGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 52, 4: 349} {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!