ID: 1122418571_1122418577

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1122418571 1122418577
Species Human (GRCh38) Human (GRCh38)
Location 14:101561643-101561665 14:101561692-101561714
Sequence CCCGCGCTTCCTCGGCACGGCCT TGTATCCGCAAGCATTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 105} {0: 1, 1: 0, 2: 0, 3: 1, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!