ID: 1122464877_1122464889

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1122464877 1122464889
Species Human (GRCh38) Human (GRCh38)
Location 14:101925253-101925275 14:101925276-101925298
Sequence CCTCCCAGGACGGCCGCTAGCCT CCGGGGCGCCGCGTCGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 69} {0: 1, 1: 0, 2: 5, 3: 54, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!