ID: 1122480226_1122480236

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1122480226 1122480236
Species Human (GRCh38) Human (GRCh38)
Location 14:102042452-102042474 14:102042490-102042512
Sequence CCCTGCAGCCGCATGCCTGCTTC ATGGAGATCAACCCCAAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 175} {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!