ID: 1122480592_1122480598

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1122480592 1122480598
Species Human (GRCh38) Human (GRCh38)
Location 14:102044719-102044741 14:102044739-102044761
Sequence CCACACGCAGGGTGGGTGGCGAG GAGGGTCCCCTCACGCGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 123} {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!