ID: 1122505570_1122505581

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1122505570 1122505581
Species Human (GRCh38) Human (GRCh38)
Location 14:102229792-102229814 14:102229822-102229844
Sequence CCACCAGGTCCCAGACACCCCAA GCTGCCCACTAGAGTCCCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282} {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!