ID: 1122506308_1122506320

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1122506308 1122506320
Species Human (GRCh38) Human (GRCh38)
Location 14:102234039-102234061 14:102234085-102234107
Sequence CCCAATATAAACCCCTCAATCTG ACTGTTAAGCGGCCGGTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 8, 3: 33, 4: 141} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!