ID: 1122563767_1122563769

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1122563767 1122563769
Species Human (GRCh38) Human (GRCh38)
Location 14:102636437-102636459 14:102636450-102636472
Sequence CCCGCTAACTTTTTGTATTTGTT TGTATTTGTTTACTAGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 194, 2: 7166, 3: 55734, 4: 43740} {0: 1, 1: 12, 2: 1016, 3: 4036, 4: 15349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!