ID: 1122608335_1122608342

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1122608335 1122608342
Species Human (GRCh38) Human (GRCh38)
Location 14:102963412-102963434 14:102963439-102963461
Sequence CCTTCCTAATCTTGTTCCCAGGC CCTCTGTTCTTCAGGGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165} {0: 1, 1: 0, 2: 2, 3: 40, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!