ID: 1122629293_1122629305

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1122629293 1122629305
Species Human (GRCh38) Human (GRCh38)
Location 14:103099927-103099949 14:103099970-103099992
Sequence CCGAGTGACGGTGGGCACCTGCG GTCTCAGGAAAGGCTCCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} {0: 1, 1: 0, 2: 0, 3: 16, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!