ID: 1122684249_1122684250

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122684249 1122684250
Species Human (GRCh38) Human (GRCh38)
Location 14:103492399-103492421 14:103492414-103492436
Sequence CCATGCATGTCTTTCATAATCAT ATAATCATCTCCAGCCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237} {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!