ID: 1122685066_1122685072

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1122685066 1122685072
Species Human (GRCh38) Human (GRCh38)
Location 14:103500120-103500142 14:103500161-103500183
Sequence CCCTCTTCTCTCTGCTTCTACAT CAACTGAATATGAGAGGAACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 116, 4: 869} {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!