ID: 1122844403_1122844408

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122844403 1122844408
Species Human (GRCh38) Human (GRCh38)
Location 14:104483760-104483782 14:104483775-104483797
Sequence CCCTAGTCTAGGAGAGAGGGACT GAGGGACTTTGCCAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 112} {0: 1, 1: 0, 2: 1, 3: 24, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!