ID: 1122864558_1122864566

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1122864558 1122864566
Species Human (GRCh38) Human (GRCh38)
Location 14:104597630-104597652 14:104597666-104597688
Sequence CCCACCAAGCGAGCTCCCAGCAG AAGAGGAACGGGCCCTCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134} {0: 1, 1: 0, 2: 3, 3: 19, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!