ID: 1122893468_1122893477

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1122893468 1122893477
Species Human (GRCh38) Human (GRCh38)
Location 14:104743739-104743761 14:104743773-104743795
Sequence CCAAAATTCCTGGAGAATTAACC AGGTGGGTATAGAGCTAATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173} {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!