ID: 1122899077_1122899090

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1122899077 1122899090
Species Human (GRCh38) Human (GRCh38)
Location 14:104774701-104774723 14:104774747-104774769
Sequence CCAGGGCCACCTGCCCCACCCAC GCACAGCCCCTAGCCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 106, 4: 872} {0: 1, 1: 0, 2: 2, 3: 27, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!