ID: 1122899078_1122899090

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1122899078 1122899090
Species Human (GRCh38) Human (GRCh38)
Location 14:104774707-104774729 14:104774747-104774769
Sequence CCACCTGCCCCACCCACCTGCCC GCACAGCCCCTAGCCCACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 41, 3: 321, 4: 2299} {0: 1, 1: 0, 2: 2, 3: 27, 4: 268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!