ID: 1122904553_1122904568

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1122904553 1122904568
Species Human (GRCh38) Human (GRCh38)
Location 14:104795770-104795792 14:104795803-104795825
Sequence CCCGCGCCCGCCCCGCGCCCGGA CACATCCGCCTCCGCCGCCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 117, 4: 4091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!