ID: 1122905694_1122905703

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1122905694 1122905703
Species Human (GRCh38) Human (GRCh38)
Location 14:104800590-104800612 14:104800618-104800640
Sequence CCCGCGCCCTCCCCGCCGGGGCG CCCGCAGCTCCACGCGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 113, 4: 4583} {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!