ID: 1122911948_1122911951

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1122911948 1122911951
Species Human (GRCh38) Human (GRCh38)
Location 14:104834427-104834449 14:104834473-104834495
Sequence CCAGCCTCCATTTAATTCTTTTG TTCAAATTTATGTTTTATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 605} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!