ID: 1122923951_1122923956

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1122923951 1122923956
Species Human (GRCh38) Human (GRCh38)
Location 14:104891350-104891372 14:104891390-104891412
Sequence CCAGGGTGGATGGCAAGTGTTTG CTTGAAGCCCATGAGGGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 235} {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!