ID: 1122924043_1122924045

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1122924043 1122924045
Species Human (GRCh38) Human (GRCh38)
Location 14:104891709-104891731 14:104891724-104891746
Sequence CCATGTGGGTTTCTGGAGTTCTC GAGTTCTCTGCCTTCCATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 261} {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!