ID: 1122937309_1122937317

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1122937309 1122937317
Species Human (GRCh38) Human (GRCh38)
Location 14:104966211-104966233 14:104966229-104966251
Sequence CCACGTCATCCCGGCCCCGCCAC GCCACCTTCCTACTGCTCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 248} {0: 1, 1: 0, 2: 2, 3: 5, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!