ID: 1122939248_1122939264

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1122939248 1122939264
Species Human (GRCh38) Human (GRCh38)
Location 14:104973879-104973901 14:104973929-104973951
Sequence CCCGCAGCCGGAGGGGAGGGGAG GCCTCTGTGGGGTGCGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 62, 4: 639} {0: 1, 1: 0, 2: 12, 3: 59, 4: 831}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!