ID: 1122947548_1122947553

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1122947548 1122947553
Species Human (GRCh38) Human (GRCh38)
Location 14:105020049-105020071 14:105020068-105020090
Sequence CCTTCTTTTCCCTGAAAACATGT ATGTTCCAGTGGCAAGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 454} {0: 1, 1: 0, 2: 0, 3: 6, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!