ID: 1122953672_1122953675

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1122953672 1122953675
Species Human (GRCh38) Human (GRCh38)
Location 14:105060173-105060195 14:105060193-105060215
Sequence CCAGCTGCTGCTCTGCCAAGATC ATCCGTGTGGCCCTGTCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 245} {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!