ID: 1122974976_1122974983

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1122974976 1122974983
Species Human (GRCh38) Human (GRCh38)
Location 14:105167389-105167411 14:105167413-105167435
Sequence CCCCAGCACGCGCTGCGCACATG CACCGCGGCCTGCCCGGGACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 0, 3: 27, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!