ID: 1123000945_1123000956

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1123000945 1123000956
Species Human (GRCh38) Human (GRCh38)
Location 14:105293767-105293789 14:105293797-105293819
Sequence CCCCCGTGGGGCCTGGCTTCCAA ACCCTCTGGGGACTCTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148} {0: 1, 1: 0, 2: 2, 3: 126, 4: 9229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!