ID: 1123014591_1123014606

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1123014591 1123014606
Species Human (GRCh38) Human (GRCh38)
Location 14:105367733-105367755 14:105367782-105367804
Sequence CCTCCCCTACTCCTCAGGCGGGG TGAAATGCCAGCTGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 162} {0: 1, 1: 0, 2: 1, 3: 24, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!