ID: 1123019836_1123019845

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1123019836 1123019845
Species Human (GRCh38) Human (GRCh38)
Location 14:105392489-105392511 14:105392530-105392552
Sequence CCCGGCCCTCCTCTGCTGGCAAG GTCACCTCCTGGCCTGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 335} {0: 1, 1: 0, 2: 1, 3: 23, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!