ID: 1123020930_1123020943

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1123020930 1123020943
Species Human (GRCh38) Human (GRCh38)
Location 14:105397635-105397657 14:105397668-105397690
Sequence CCAGTGTCCTGGTTCAGTGCCTC GGGGCAGGAGAGGGGCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 297} {0: 1, 1: 1, 2: 16, 3: 77, 4: 699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!