ID: 1123480694_1123480705

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1123480694 1123480705
Species Human (GRCh38) Human (GRCh38)
Location 15:20628764-20628786 15:20628804-20628826
Sequence CCGGGACTGCGCCGCTCACAGCG GGCCTCGGAGGCAGTGGCGGTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 17, 3: 61, 4: 717}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!