ID: 1123649052_1123649058

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1123649052 1123649058
Species Human (GRCh38) Human (GRCh38)
Location 15:22464352-22464374 15:22464372-22464394
Sequence CCAAGCTCCTGCTGCCACAGGTG GTGAGCAGCTGCAGCCCCGGGGG
Strand - +
Off-target summary {0: 6, 1: 3, 2: 3, 3: 54, 4: 446} {0: 6, 1: 4, 2: 6, 3: 36, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!