ID: 1123729275_1123729282

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1123729275 1123729282
Species Human (GRCh38) Human (GRCh38)
Location 15:23131301-23131323 15:23131327-23131349
Sequence CCACAACCCCCGGGGCTGCAGCT CACCTGTGGCAGCAGGAGCTTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 5, 3: 76, 4: 794} {0: 6, 1: 3, 2: 3, 3: 54, 4: 446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!