ID: 1123732799_1123732803

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1123732799 1123732803
Species Human (GRCh38) Human (GRCh38)
Location 15:23160489-23160511 15:23160504-23160526
Sequence CCTCTTGGGGAAGTGCTAGCCTG CTAGCCTGACTGGTTGTCAGGGG
Strand - +
Off-target summary {0: 16, 1: 5, 2: 0, 3: 17, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!