ID: 1123750474_1123750485

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1123750474 1123750485
Species Human (GRCh38) Human (GRCh38)
Location 15:23355027-23355049 15:23355078-23355100
Sequence CCACCAAAGTTTTGCCAGTCAGC CTGCCCTCACCAATCACCCCAGG
Strand - +
Off-target summary {0: 4, 1: 9, 2: 8, 3: 19, 4: 107} {0: 7, 1: 4, 2: 42, 3: 30, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!